KIAA0154

Product ID	ORK00433
Accession No	D63876
Description	golgi-associated, gamma adaptin ear containing, ARF binding protein 3, transcript variant short
Clone name	ha03131
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3760 bp) Predicted protein sequence (692 aa)
HaloTag ORF Clone	FHC00433
Flexi ORF Clone	FXC00433
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0154 by Kazusa Mouse cDNA Project

Length: 3760 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1679 bp
Genome contig ID	gi51511734r_70644290
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTGCTGCATGTTAAATAAAACCATTTTCACTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGGAATCTTCCTAGTATAGACGCCATTCACCCTGATGGAGGAAAAGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	70744290	70769271	16	99.4	Perfect prediction

Length: 692 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF05709	1.4e-208	100.0	ADP-ribosylatio...	Homo sapiens
BAF84374	2.2e-208	99.9	unnamed protein...	Homo sapiens
AAH70044	2.5e-208	99.9	Golgi associate...	Homo sapiens
EAW89258	4.7e-187	100.0	golgi associate...	Homo sapiens
Q9NZ52	5.1e-187	95.4	ADP-ribosylatio...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029003	3.6e-16	37.3	KIAA1080
AB002307	0.00088	29.5	KIAA0309

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002014	7	126	PD003686	VHS
BlastProDom	IPR008153	550	691	PD021457	Clathrin adaptor
HMMPfam	IPR002014	5	111	PF00790	VHS
	IPR004152	175	276	PF03127	GAT
	IPR008152	560	684	PF02883	Clathrin adaptor
HMMSmart	IPR002014	11	145	SM00288	VHS
HMMSmart	IPR008152	560	684	SM00809	Clathrin adaptor
ProfileScan	IPR002014	18	115	PS50179	VHS
	IPR004152	140	267	PS50909	GAT
	IPR008153	563	684	PS50180	Clathrin adaptor

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TGTACTCCAAGCCTCCGTCAC
Primer_r	TCCTTTCCCCAGAGATGTCCG
PCR product length	112 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles