KIAA1080

Product ID	ORK05288
Accession No	AB029003
Description	golgi-associated, gamma adaptin ear containing, ARF binding protein 2
Clone name	hj07082
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4791 bp) Predicted protein sequence (517 aa)
Source	Human adult brain
Rouge ID	mKIAA1080 by Kazusa Mouse cDNA Project

Length: 4791 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3236 bp
Genome contig ID	gi51511732r_23283146
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTCACCACAGCCACAATAAAGTCCTTTCAAGCCCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GATAATGCCATGTTTTGTCCTAACCTTTTGCTGCAGTTAATTACTCTTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	23383146	23412245	15	98.9	Perfect prediction

Length: 517 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF35394	1.3e-192	99.8	gamma-adaptin r...	Homo sapiens
AAF05708	5e-192	99.6	ADP-ribosylatio...	Homo sapiens
XP_001162172	2.8e-185	96.5	ADP-ribosylatio...	Pan troglodytes
XP_001162100	2.9e-185	96.5	ADP-ribosylatio...	Pan troglodytes
XP_001162281	4.8e-185	96.3	ADP-ribosylatio...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63876	1.4e-26	37.1	KIAA0154

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002014	1	63	PD003686	VHS
BlastProDom	IPR008153	375	509	PD021457	Clathrin adaptor
HMMPfam	IPR002014	1	63	PF00790	VHS
	IPR004152	127	228	PF03127	GAT
	IPR008152	385	509	PF02883	Clathrin adaptor
HMMSmart	IPR008152	385	509	SM00809	Clathrin adaptor
ProfileScan	IPR002014	1	67	PS50179	VHS
	IPR004152	92	219	PS50909	GAT
	IPR008153	388	509	PS50180	Clathrin adaptor

Primer_f	TCTGTCCCAATTCTGAGTAAC
Primer_r	CAGATGATACCAGAAGGGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-