Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00453 |
---|---|
Accession No | D83782 |
Description | SREBF chaperone |
Clone name | ha03150s1 |
Vector information | |
cDNA sequence | DNA sequence (4226 bp) Predicted protein sequence (1283 aa) |
HaloTag ORF Clone |
FHC00453
|
Flexi ORF Clone | FXC00453 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0199
by Kazusa Mouse cDNA Project
|
Note | We replaced ha03150, former representative clones for KIAA0199 with ha03150s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 141 bp |
---|---|
Genome contig ID | gi89161205r_47330207 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 47430207 | 47492439 | 23 | 100.0 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001680 | 1096 | 1110 | PR00320 | WD40 repeat |
IPR001680 | 1137 | 1151 | PR00320 | WD40 repeat | |
IPR001680 | 1177 | 1191 | PR00320 | WD40 repeat | |
HMMPfam | IPR001680 | 770 | 806 | PF00400 | WD40 repeat |
IPR001680 | 1073 | 1109 | PF00400 | WD40 repeat | |
IPR001680 | 1113 | 1150 | PF00400 | WD40 repeat | |
IPR001680 | 1154 | 1190 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 769 | 806 | SM00320 | WD40 repeat |
IPR001680 | 959 | 997 | SM00320 | WD40 repeat | |
IPR001680 | 1071 | 1109 | SM00320 | WD40 repeat | |
IPR001680 | 1112 | 1150 | SM00320 | WD40 repeat | |
IPR001680 | 1153 | 1190 | SM00320 | WD40 repeat | |
IPR001680 | 1193 | 1230 | SM00320 | WD40 repeat | |
ProfileScan | IPR000731 | 288 | 446 | PS50156 | Sterol-sensing 5TM box |
IPR001680 | 1079 | 1239 | PS50294 | WD40 repeat | |
IPR001680 | 1119 | 1159 | PS50082 | WD40 repeat | |
ScanRegExp | IPR001680 | 1137 | 1151 | PS00678 | WD40 repeat |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 25 | LCASYPIPIILFTGFCILACCYP | 47 | PRIMARY | 23 | 2 | 284 | IGVAELIPLVTTYIILFAYIYFS | 306 | PRIMARY | 23 | 3 | 319 | LALAAVVTVLSSLLMSVGLCTLF | 341 | PRIMARY | 23 | 4 | 353 | FPYLVVVIGLENVLVLTKSVVST | 375 | SECONDARY | 23 | 5 | 401 | ATELGIILIGYFTLVPAIQEFCL | 423 | PRIMARY | 23 | 6 | 427 | VGLVSDFFLQMLFFTTVLSIDI | 448 | SECONDARY | 22 | 7 | 714 | KVAALGLATGIVLVLLLLCLYRV | 736 | PRIMARY | 23 | 8 | 776 | LRGHLMDIECLASDGMLLVSCCL | 798 | SECONDARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | GCCTGGTGTATGTGCCCTCTG |
Primer_r | CGGCTGGAAGATACTCGGCTC |
PCR product length | 140 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |