Gene/Protein Characteristic Table for KIAA0186
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00448
Accession No D80008
Description GINS complex subunit 1 (Psf1 homolog)
Clone name ha03207
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (3248 bp)
Predicted protein sequence (226 aa)
Flexi ORF Clone FXC00448
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA0186 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 3248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 226 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001107106 6.1e-94 95.5 similar to DNA ...
Macaca mulatta
AAH12542 3.3e-86 99.5 GINS1 protein [...
Homo sapiens
XP_848652 6.3e-84 95.4 similar to DNA ...
Canis lupus fam...
Q9CZ15 1.7e-82 93.4 DNA replication...
Mus musculus
A4IFH4 3.2e-81 92.9 DNA replication...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR005339 31 168 PD022798 GINS complex
HMMPfam IPR005339 31 224 PF03651 GINS complex
Expression profile
Description

Northern blot
Experimental conditions
Primer_f
Primer_r
PCR conditions test

RH mapping information
Description

Chromosome No. 20
Experimental conditions
Panel name Genebridge 4
Primer_f CTGTTGGGCACCTTGATTGAG
Primer_r TAATACCTAGGAAGACAGACC
PCR product length 117 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp