KIAA0157

Product ID	ORK00435
Accession No	D63877
Description	family with sequence similarity 175, member B
Clone name	ha03221
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2957 bp) Predicted protein sequence (419 aa)
HaloTag ORF Clone	FHC00435
Flexi ORF Clone	FXC00435
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0157 by Kazusa Mouse cDNA Project

Length: 2957 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1695 bp
Genome contig ID	gi89161187f_126380375
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- GTTAAATGTGACAATAAAAAACTTATTTAATCATG
Flanking genome sequence (134853 - 134902)	----+--------+--------+--------+--------+----* GTACCATTGTTTTAATGTCTGTCTCAGCACCGGACAAGGCCTTGCCTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	126480375	126515226	9	99.1	Perfect prediction

Length: 419 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001083977	6.4e-145	98.8	hypothetical pr...	Macaca mulatta
BAG59274	3.8e-144	99.3	unnamed protein...	Homo sapiens
XP_535051	8.8e-139	95.2	hypothetical pr...	Canis lupus fam...
EDL17753	1.7e-135	93.1	RIKEN cDNA C430...	Mus musculus
XP_587356	3.7e-135	93.3	hypothetical pr...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 10

Experimental conditions

Panel name	Genebridge 4
Primer_f	ACCACTAAGACATTCAGGAGC
Primer_r	AAGACAGACCCCCATAGAGTG
PCR product length	314 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles