KIAA0159

Product ID	ORK00032
Accession No	D63880
Description	non-SMC condensin I complex, subunit D2
Clone name	ha03574
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5547 bp) Predicted protein sequence (1406 aa)
HaloTag ORF Clone	FHC00032
Flexi ORF Clone	FXC00032
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0159 by Kazusa Mouse cDNA Project

Length: 5547 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	542 bp
Genome contig ID	gi89161190f_6372806
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTTTTCTAATGAATAAATGTTTTTATATACTTTT
Flanking genome sequence (138577 - 138626)	----+--------+--------+--------+--------+----* AGACATTTTTTCCTAAGCTTGTCTTTGTTTCATCTTTCACATTAGCCCAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	6472806	6511381	32	99.7	Perfect prediction

Length: 1406 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11144	100.0	condensin compl...	synthetic construct
EAW88788	99.9	chromosome cond...	Homo sapiens
Q15021	99.8	Condensin compl...	Homo sapiens
NP_055680	99.8	non-SMC condens...	Homo sapiens
XP_001161617	99.6	chromosome cond...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D29954	1.1e-05	22.8	KIAA0056

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	364	400	PF02985	HEAT

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	GACTCGTCGCTAAGATTCCCC
Primer_r	CAACCTTCATTTCCTTCACGG
PCR product length	96 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles