Order Kazusa clone(s) from : ![]() |
Product ID | ORK00040 |
---|---|
Accession No | D87685 |
Description | PHD finger protein 3, transcript variant 1 |
Clone name | ha04644s1 |
Vector information | |
cDNA sequence | DNA sequence (6936 bp) Predicted protein sequence (2044 aa) |
Flexi ORF Clone |
FXC00040
![]() |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0244
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04644, former representative clones for KIAA0244 with ha04644s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 801 bp |
---|---|
Genome contig ID | gi89161210f_64314401 |
PolyA signal sequence (AGTAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (167965 - 168014) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 64414401 | 64482364 | 15 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001965 | 724 | 777 | PF00628 | Zinc finger |
IPR003618 | 932 | 1045 | PF07500 | Transcription elongation factor S-II | |
IPR012921 | 1214 | 1320 | PF07744 | Spen paralogue and orthologue C-terminal | |
HMMSmart | IPR001965 | 724 | 775 | SM00249 | Zinc finger |
IPR003618 | 934 | 1034 | SM00510 | Transcription elongation factor S-II | |
ProfileScan | IPR001965 | 722 | 777 | PS50016 | Zinc finger |
ScanRegExp | IPR001965 | 725 | 774 | PS01359 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | CATCCCTTCTTCATACCAACG |
Primer_r | TTGGGCTTCTGATTCTTGGTC |
PCR product length | 351 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |