Order Kazusa clone(s) from : ![]() |
Product ID | ORK00471 |
---|---|
Accession No | D87078 |
Description | pumilio RNA-binding family member 2, transcript variant 1 |
Clone name | ha04677s1 |
Vector information | |
cDNA sequence | DNA sequence (6040 bp) Predicted protein sequence (1064 aa) |
HaloTag ORF Clone |
FHC00471
![]() |
Flexi ORF Clone | FXC00471 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0235
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04677, former representative clones for KIAA0235 with ha04677s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 2845 bp |
---|---|
Genome contig ID | gi89161199r_20211982 |
PolyA signal sequence (AATGAA,-33) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 20311982 | 20390602 | 20 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001313 | 726 | 760 | PF00806 | Pumilio/Puf RNA-binding |
IPR001313 | 762 | 796 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 798 | 832 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 834 | 868 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 870 | 904 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 906 | 940 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 942 | 976 | PF00806 | Pumilio/Puf RNA-binding | |
IPR001313 | 985 | 1019 | PF00806 | Pumilio/Puf RNA-binding | |
HMMSmart | IPR001313 | 726 | 761 | SM00025 | Pumilio/Puf RNA-binding |
IPR001313 | 762 | 797 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 798 | 833 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 834 | 869 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 870 | 905 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 906 | 941 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 942 | 977 | SM00025 | Pumilio/Puf RNA-binding | |
IPR001313 | 985 | 1020 | SM00025 | Pumilio/Puf RNA-binding | |
ProfileScan | IPR001313 | 706 | 1046 | PS50303 | Pumilio/Puf RNA-binding |
IPR001313 | 726 | 761 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 762 | 797 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 798 | 833 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 834 | 869 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 870 | 905 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 906 | 941 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 942 | 977 | PS50302 | Pumilio/Puf RNA-binding | |
IPR001313 | 978 | 1020 | PS50302 | Pumilio/Puf RNA-binding |
Panel name | Genebridge 4 |
---|---|
Primer_f | TTCATCCTTGCCCTCTGTTGG |
Primer_r | TATTGGGAAGATTGGGTTGTC |
PCR product length | 152 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |