Gene/Protein Characteristic Table for KIAA2018
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05746
Accession No AB095938
Description KIAA2018
Clone name ha04734
Vector information
The cDNA fragment was inserted at the EcoRV-NotI site of the ...
cDNA sequence DNA sequence (6335 bp)
Predicted protein sequence (1685 aa)
Source Myeloblast cell line (KG-1)
Rouge ID mKIAA2018 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6335 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1685 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW79632 0 100.0 hCG1642841 [Hom...
Homo sapiens
NP_001009899 0 99.9 hypothetical pr...
Homo sapiens
CAH18277 0 99.8 hypothetical pr...
Homo sapiens
XP_001106577 0 97.0 similar to gene...
Macaca mulatta
XP_001502915 0 90.5 hypothetical pr...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058722 0.00095 22.9 KIAA1819
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGGCAGTATGATTCTTGGACG
Primer_r GGCTGAGTAACCTGTGGAATG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp