KIAA1819

Product ID	ORK01637
Accession No	AB058722
Description	mastermind-like transcriptional coactivator 2
Clone name	hh00456
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5419 bp) Predicted protein sequence (1173 aa)
HaloTag ORF Clone	FHC01637
Flexi ORF Clone	FXC01637
Source	Human adult brain
Rouge ID	mKIAA1819 by Kazusa Mouse cDNA Project

Length: 5419 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	672 bp
Genome contig ID	gi51511727r_95251088
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GCTGTGTCTAGTGATTAAACAAAAATATAGAGCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCAATTTGATTTTGGCTTCCACAACGAATATCTGAATCCATTCCAAATG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	95351088	95715992	5	99.4	Perfect prediction

Length: 1173 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8IZL2	100.0	Mastermind-like...	Homo sapiens
NP_115803	99.7	mastermind-like...	Homo sapiens
EAW66975	99.7	mastermind-like...	Homo sapiens
AAI43530	99.8	MAML2 protein [...	Homo sapiens
XP_001147268	98.7	mastermind-like...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058719	7.1e-12	28.4	KIAA1816
D83783	2.1e-09	32.9	KIAA0192
D83785	1.3e-08	26.6	KIAA0200
D80003	5.5e-06	25.4	KIAA0181
AB058721	5.7e-05	23.5	KIAA1818

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	AACCTAGAAAACATCCAGTGG
Primer_r	TCACTAGACACAGCATCCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AACCTAGAAAACATCCAGTGG
Primer_r	TCACTAGACACAGCATCCCAC
PCR product length	95 bp
PCR conditions	15 °C62 sec60 °C30 sec107 cycles