Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK01589 |
---|---|
Accession No | D83783 |
Description | mediator complex subunit 12 |
Clone name | ha02370 |
Vector information | |
cDNA sequence | DNA sequence (6604 bp) Predicted protein sequence (2124 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0192
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 229 bp |
---|---|
Genome contig ID | gi89161218f_70156008 |
PolyA signal sequence (AATACA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (123016 - 123065) |
----+----*----+----*----+----*----+----*----+----* |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 221 | KLLLPLLLRYSGEFVQSAYLSR | 242 | SECONDARY | 22 | 2 | 307 | FGLSCILQTILLCCPSALVWHYS | 329 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | CGTTGTAATACCCTTCCTGAC |
Primer_r | TTTTGGCTAGTTGCGTGAGTG |
PCR product length | 151 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |