Gene/Protein Characteristic Table for KIAA1816
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK02055
Accession No AB058719
Description mastermind-like transcriptional coactivator 3
Clone name fh16716
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5164 bp)
Predicted protein sequence (1162 aa)
Flexi ORF Clone FXC02055
Source Human fetal brain
Rouge ID mKIAA1816 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5164 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1162 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG53919 0 99.9 unnamed protein...
Homo sapiens
BAG72619 0 100.0 mastermind-like...
synthetic construct
EAX05107 0 99.9 mastermind-like...
Homo sapiens
Q96JK9 0 99.8 Mastermind-like...
Homo sapiens
XP_526693 0 99.3 mastermind-like...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
D83785 3.7e-19 35.4 KIAA0200
AB058722 1.3e-11 28.7 KIAA1819
D80003 4e-05 25.1 KIAA0181
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f GGAGCTTGATGAATTGTTTGG
Primer_r CAGTTTTGCTCAGTTTACGTG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 4
Experimental conditions
Panel name CCR
Primer_f GGAGCTTGATGAATTGTTTGG
Primer_r CAGTTTTGCTCAGTTTACGTG
PCR product length 95 bp
PCR conditions 15 °C62 sec60 °C30 sec151 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp