KIAA0181

Product ID	ORK00447
Accession No	D80003
Description	nuclear receptor coactivator 6, transcript variant 1
Clone name	ha02522s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6813 bp) Predicted protein sequence (2079 aa)
HaloTag ORF Clone	FHC00447
Flexi ORF Clone	FXC00447
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0181 by Kazusa Mouse cDNA Project
Note	We replaced ha02522, former representative clones for KIAA0181 with ha02522s1. (2002/5/10)

Length: 6813 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	484 bp
Genome contig ID	gi51511747r_32666300
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- GTGAATAAAGAGAATCTAAGGATTTGTACAATGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATAACGTGTTAAATAAATGTCATTGTCATAGAACATAAAGTTATGTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	20	r	32766300	32844001	14	99.7	Perfect prediction

Length: 2079 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAF13595	100.0	cancer-amplifie...	Homo sapiens
Q14686	100.0	Nuclear recepto...	Homo sapiens
XP_001160316	99.3	nuclear recepto...	Pan troglodytes
XP_001103488	98.5	similar to nucl...	Macaca mulatta
AAF16403	99.9	transcriptional...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058722	0.00029	25.2	KIAA1819
AB058719	0.001	25.1	KIAA1816

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2	FLIVLLAYASGIIFTMVLDDLPN	24	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	TTTCACATTTCCTAAGCAGCC
Primer_r	TTGCTTTTGCCCCCACTACTG
PCR product length	110 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles