KIAA0219

Product ID	ORK05284
Accession No	D86973
Description	GCN1 eIF2 alpha kinase activator homolog
Clone name	ha04759s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a cDNA fragment (1-932) was subcloned upstream of the cDNA (933-8608). The adjacent sequence to the 5' end of the cDNA is as follows: CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA.
cDNA sequence	DNA sequence (8608 bp) Predicted protein sequence (2675 aa)
HaloTag ORF Clone	FHC05284
Flexi ORF Clone	FXC05284
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0219 by Kazusa Mouse cDNA Project
Note	We replaced ha04759, former representative clones for KIAA0219 with ha04759s1. (2002/5/10)

Length: 8608 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	579 bp
Genome contig ID	gi89161190r_118949457
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGAGGAATGTTTAATAAAGGCTTTGATTTAATCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GATATAAACAGATTTTTAAAAATCTCCACCCATTAAACATGAAGCTTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	119049457	119116896	58	99.8	Perfect prediction

Length: 2675 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92616	100.0	Translational a...	Homo sapiens
NP_006827	100.0	GCN1 general co...	Homo sapiens
XP_001159608	99.7	GCN1 general co...	Pan troglodytes
XP_534701	96.8	similar to GCN1...	Canis lupus fam...
XP_001488898	96.8	GCN1 general co...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	1458	1494	PF02985	HEAT
	IPR000357	1497	1532	PF02985	HEAT
	IPR000357	1537	1573	PF02985	HEAT
	IPR000357	1614	1650	PF02985	HEAT
	IPR000357	1656	1692	PF02985	HEAT
	IPR000357	1776	1812	PF02985	HEAT
	IPR000357	1814	1850	PF02985	HEAT
	IPR000357	1924	1960	PF02985	HEAT
	IPR000357	1962	1998	PF02985	HEAT
	IPR000357	2004	2040	PF02985	HEAT
	IPR000357	2191	2227	PF02985	HEAT
	IPR000357	2346	2382	PF02985	HEAT
	IPR000357	2425	2461	PF02985	HEAT
	IPR000357	2591	2627	PF02985	HEAT
ProfileScan	IPR000357	1620	1658	PS50077	HEAT
	IPR000357	1662	1700	PS50077	HEAT
	IPR000357	2010	2047	PS50077	HEAT

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	114	GSAALLALTWTCLLVRIVFPSR	135	PRIMARY	22
SOSUI2	2	141	DIWNKLVEVQCLLLLEVLGGSHK	163	SECONDARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTGGGTTCCTCTTCTCCTGTG
Primer_r	AAAAGCCAAGCCAGACACACC
PCR product length	127 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles