Order Kazusa clone(s) from : ![]() |
Product ID | ORK05284 |
---|---|
Accession No | D86973 |
Description | GCN1 eIF2 alpha kinase activator homolog |
Clone name | ha04759s1 |
Vector information | |
cDNA sequence | DNA sequence (8608 bp) Predicted protein sequence (2675 aa) |
HaloTag ORF Clone |
FHC05284
![]() |
Flexi ORF Clone | FXC05284 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0219
by Kazusa Mouse cDNA Project
|
Note | We replaced ha04759, former representative clones for KIAA0219 with ha04759s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 579 bp |
---|---|
Genome contig ID | gi89161190r_118949457 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 12 | r | 119049457 | 119116896 | 58 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000357 | 1458 | 1494 | PF02985 | HEAT |
IPR000357 | 1497 | 1532 | PF02985 | HEAT | |
IPR000357 | 1537 | 1573 | PF02985 | HEAT | |
IPR000357 | 1614 | 1650 | PF02985 | HEAT | |
IPR000357 | 1656 | 1692 | PF02985 | HEAT | |
IPR000357 | 1776 | 1812 | PF02985 | HEAT | |
IPR000357 | 1814 | 1850 | PF02985 | HEAT | |
IPR000357 | 1924 | 1960 | PF02985 | HEAT | |
IPR000357 | 1962 | 1998 | PF02985 | HEAT | |
IPR000357 | 2004 | 2040 | PF02985 | HEAT | |
IPR000357 | 2191 | 2227 | PF02985 | HEAT | |
IPR000357 | 2346 | 2382 | PF02985 | HEAT | |
IPR000357 | 2425 | 2461 | PF02985 | HEAT | |
IPR000357 | 2591 | 2627 | PF02985 | HEAT | |
ProfileScan | IPR000357 | 1620 | 1658 | PS50077 | HEAT |
IPR000357 | 1662 | 1700 | PS50077 | HEAT | |
IPR000357 | 2010 | 2047 | PS50077 | HEAT |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 114 | GSAALLALTWTCLLVRIVFPSR | 135 | PRIMARY | 22 | 2 | 141 | DIWNKLVEVQCLLLLEVLGGSHK | 163 | SECONDARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | GTGGGTTCCTCTTCTCCTGTG |
Primer_r | AAAAGCCAAGCCAGACACACC |
PCR product length | 127 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |