Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK05586 |
---|---|
Accession No | D87682 |
Description | AVL9 homolog (S. cerevisiase) |
Clone name | ha04847 |
Vector information | |
cDNA sequence | DNA sequence (6371 bp) Predicted protein sequence (522 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0241
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4802 bp |
---|---|
Genome contig ID | gi89161213f_32450829 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (144021 - 144070) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 32550824 | 32594848 | 12 | 99.1 | Perfect prediction |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 134 | KVLFYISPVNKLVGALMTVLSLF | 156 | PRIMARY | 23 | 2 | 438 | AQFAVYIHALLAATLQLVLFRIV | 460 | PRIMARY | 23 |
---|
Panel name | Genebridge 4 |
---|---|
Primer_f | GTGAAGGCATTTAGTGGTTAC |
Primer_r | TACCAGAGCAAAGAGAACTAC |
PCR product length | 165 bp |
PCR conditions | 95 °C15 sec60 °C60 sec30 cycles |