KIAA0275

Product ID	ORK00488
Accession No	D87465
Description	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 2, transcript variant 2
Clone name	ha06214
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5316 bp) Predicted protein sequence (510 aa)
HaloTag ORF Clone	FHC00488
Flexi ORF Clone	FXC00488
Source	Human adult brain
Rouge ID	mKIAA0275 by Kazusa Mouse cDNA Project

Length: 5316 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3725 bp
Genome contig ID	gi89161187r_73388799
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTAAGAAAATGGAAAATAAAAACTTTATAAACACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCTGCTGGCAATACTCTGATTATTCTTACCCTTGGTATTATTTTTCACG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	73488799	73518778	11	99.0	Terminal No-hit

Length: 510 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q92563	8.3e-180	100.0	Testican-2; SPA...	Homo sapiens
XP_001136277	2.6e-179	99.8	sparc/osteonect...	Pan troglodytes
BAF85017	4.1e-179	99.8	unnamed protein...	Homo sapiens
AAQ89280	9.6e-179	99.8	SPOCK2 [Homo sa...	Homo sapiens
EAW54442	9.7e-178	99.3	sparc/osteonect...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011497	221	266	PF07648	Protease inhibitor
HMMPfam	IPR000716	399	462	PF00086	Thyroglobulin type-1
HMMSmart	IPR002350	221	266	SM00280	Proteinase inhibitor I1
HMMSmart	IPR000716	420	466	SM00211	Thyroglobulin type-1
ProfileScan	IPR000716	396	462	PS51162	Thyroglobulin type-1
ScanRegExp	IPR000716	419	448	PS00484	Thyroglobulin type-1

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTGTGTGCGTGTGCGTTGATG
Primer_r	GGCAGATAAAGACGACACGAG
PCR product length	135 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles