Order Kazusa clone(s) from : ![]() |
Product ID | ORK00480 |
---|---|
Accession No | D87442 |
Description | nicastrin, transcript variant 1 |
Clone name | ha07036 |
Vector information | |
cDNA sequence | DNA sequence (2805 bp) Predicted protein sequence (708 aa) |
HaloTag ORF Clone |
FHC00480
![]() |
Flexi ORF Clone | FXC00480 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0253
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 677 bp |
---|---|
Genome contig ID | gi89161185f_158479813 |
PolyA signal sequence (ATTAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (115551 - 115600) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 158579813 | 158595362 | 17 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | GACTGGGAAGGACATAAAAGG |
Primer_r | AGAAAGGACAGTGGGAAGGAG |
PCR product length | 109 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |