KIAA0264

Product ID	ORK00483
Accession No	D87453
Description	mitochondrial ribosomal protein S27, transcript variant 2
Clone name	ha07040
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2635 bp) Predicted protein sequence (415 aa)
HaloTag ORF Clone	FHC00483
Flexi ORF Clone	FXC00483
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0264 by Kazusa Mouse cDNA Project

Length: 2635 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1385 bp
Genome contig ID	gi51511721r_71451107
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAGCCTCTGGAAATAAATGTTCCGGGATCATGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGTGTACTCTTTATCTTTGGGGAAAGGGAGGAGGGAGAGGGACTCATTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	71551107	71651809	11	99.3	Perfect prediction

Length: 415 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09682	1e-159	100.0	mitochondrial 2...	synthetic construct
Q92552	3.8e-159	99.8	28S ribosomal p...	Homo sapiens
CAH92755	3.7e-158	99.0	hypothetical pr...	Pongo abelii
XP_001098829	1.3e-150	94.4	similar to mito...	Macaca mulatta
XP_001154270	3.7e-139	93.7	mitochondrial r...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f
Primer_r
PCR conditions	test

Chromosome No. 5

Experimental conditions

Panel name	Genebridge 4
Primer_f	GAAAATGAGAGATGGGTTGGG
Primer_r	CTTAAGGGCAACACTACATAG
PCR product length	147 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles