KIAA0261

Product ID	ORK01969
Accession No	D87450
Description	wings apart-like homolog (Drosophila)
Clone name	ha07054
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6155 bp) Predicted protein sequence (1287 aa)
HaloTag ORF Clone	FHC01969
Flexi ORF Clone	FXC01969
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0261 by Kazusa Mouse cDNA Project

Length: 6155 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2289 bp
Genome contig ID	gi89161187r_88084994
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AATTTTAACTCAAATAAAATTGCTACTTTCAATAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACATGTTGTCTTTAACATAAGTCTATTGGAGGACAGAAGTGTCACAAACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	88184994	88271505	20	99.6	Perfect prediction

Length: 1287 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH73376	100.0	wings apart-lik...	Homo sapiens
EAW80334	99.6	wings apart-lik...	Homo sapiens
AAO14651	96.2	FOE [Homo sapiens].	Homo sapiens
Q7Z5K2	100.0	Wings apart-lik...	Homo sapiens
XP_001789110	93.1	similar to wing...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012502	733	1096	PF07814	Wings apart-like

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	AATTGTCGAGCACTGATAGAG
Primer_r	TTAAGTCAGCCTCAAGTACCC
PCR product length	140 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles