Order Kazusa clone(s) from : ![]() |
Product ID | ORK01969 |
---|---|
Accession No | D87450 |
Description | wings apart-like homolog (Drosophila) |
Clone name | ha07054 |
Vector information | |
cDNA sequence | DNA sequence (6155 bp) Predicted protein sequence (1287 aa) |
HaloTag ORF Clone |
FHC01969
![]() |
Flexi ORF Clone | FXC01969 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0261
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2289 bp |
---|---|
Genome contig ID | gi89161187r_88084994 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 88184994 | 88271505 | 20 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Panel name | Genebridge 4 |
---|---|
Primer_f | AATTGTCGAGCACTGATAGAG |
Primer_r | TTAAGTCAGCCTCAAGTACCC |
PCR product length | 140 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |