Order Kazusa clone(s) from : ![]() |
Product ID | ORK01663 |
---|---|
Accession No | D87448 |
Description | topoisomerase (DNA) II binding protein 1 |
Clone name | ha07059 |
Vector information | |
cDNA sequence | DNA sequence (5298 bp) Predicted protein sequence (1550 aa) |
HaloTag ORF Clone |
FHC01663
![]() |
Flexi ORF Clone | FXC01663 |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0259
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 644 bp |
---|---|
Genome contig ID | gi89161205r_134702140 |
PolyA signal sequence (GATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 134802140 | 134863380 | 28 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001357 | 129 | 204 | PF00533 | BRCT |
IPR001357 | 223 | 299 | PF00533 | BRCT | |
IPR001357 | 382 | 459 | PF00533 | BRCT | |
IPR001357 | 576 | 648 | PF00533 | BRCT | |
IPR001357 | 669 | 753 | PF00533 | BRCT | |
IPR001357 | 928 | 1006 | PF00533 | BRCT | |
IPR001357 | 1288 | 1366 | PF00533 | BRCT | |
HMMSmart | IPR001357 | 131 | 207 | SM00292 | BRCT |
IPR001357 | 225 | 302 | SM00292 | BRCT | |
IPR001357 | 384 | 462 | SM00292 | BRCT | |
IPR001357 | 578 | 651 | SM00292 | BRCT | |
IPR001357 | 671 | 756 | SM00292 | BRCT | |
IPR001357 | 930 | 1009 | SM00292 | BRCT | |
IPR001357 | 1290 | 1369 | SM00292 | BRCT | |
ProfileScan | IPR001357 | 129 | 200 | PS50172 | BRCT |
IPR001357 | 223 | 312 | PS50172 | BRCT | |
IPR001357 | 382 | 472 | PS50172 | BRCT | |
IPR001357 | 576 | 661 | PS50172 | BRCT | |
IPR001357 | 669 | 766 | PS50172 | BRCT | |
IPR001357 | 928 | 1019 | PS50172 | BRCT | |
IPR001357 | 1287 | 1379 | PS50172 | BRCT |
Panel name | Genebridge 4 |
---|---|
Primer_f | CTGAGCACAAGGTTTAATGAG |
Primer_r | CAAACTTGGCAAACATCATGG |
PCR product length | 98 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |