KIAA0259

Product ID	ORK01663
Accession No	D87448
Description	topoisomerase (DNA) II binding protein 1
Clone name	ha07059
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5298 bp) Predicted protein sequence (1550 aa)
HaloTag ORF Clone	FHC01663
Flexi ORF Clone	FXC01663
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0259 by Kazusa Mouse cDNA Project

Length: 5298 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	644 bp
Genome contig ID	gi89161205r_134702140
PolyA signal sequence (GATAAA,-20)	+--------+--------+----*----+---- AGATGTGTTTACATAGATAAATTTTTTAAAAGAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTGGCATCTGTTCTTCTGTTGAAGCAACAAAACATTTATGTAACGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	134802140	134863380	28	99.9	Perfect prediction

Length: 1550 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_516761	99.5	topoisomerase (...	Pan troglodytes
Q92547	100.0	DNA topoisomera...	Homo sapiens
EAW79173	99.9	topoisomerase (...	Homo sapiens
XP_001112636	97.6	topoisomerase (...	Macaca mulatta
BAH13754	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001357	129	204	PF00533	BRCT
	IPR001357	223	299	PF00533	BRCT
	IPR001357	382	459	PF00533	BRCT
	IPR001357	576	648	PF00533	BRCT
	IPR001357	669	753	PF00533	BRCT
	IPR001357	928	1006	PF00533	BRCT
	IPR001357	1288	1366	PF00533	BRCT
HMMSmart	IPR001357	131	207	SM00292	BRCT
	IPR001357	225	302	SM00292	BRCT
	IPR001357	384	462	SM00292	BRCT
	IPR001357	578	651	SM00292	BRCT
	IPR001357	671	756	SM00292	BRCT
	IPR001357	930	1009	SM00292	BRCT
	IPR001357	1290	1369	SM00292	BRCT
ProfileScan	IPR001357	129	200	PS50172	BRCT
	IPR001357	223	312	PS50172	BRCT
	IPR001357	382	472	PS50172	BRCT
	IPR001357	576	661	PS50172	BRCT
	IPR001357	669	766	PS50172	BRCT
	IPR001357	928	1019	PS50172	BRCT
	IPR001357	1287	1379	PS50172	BRCT

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTGAGCACAAGGTTTAATGAG
Primer_r	CAAACTTGGCAAACATCATGG
PCR product length	98 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles