KIAA1915

Product ID	ORK06089
Accession No	AB067502
Description	Myb-like, SWIRM and MPN domains 1
Clone name	hf00664
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hf00664 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (7801 bp) Predicted protein sequence (726 aa)
Source	Human adult brain
Rouge ID	mKIAA1915 by Kazusa Mouse cDNA Project

Length: 7801 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5265 bp
Genome contig ID	gi89161185r_58793000
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- AAATTCCATAAAAATAAAATTTTGAAAATAAAGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCATTTGGATTATTTCTAAATTATTAGCAATATACACATTGAATTGCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	58893000	58927922	16	99.2	Perfect prediction

Length: 726 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5VVJ2	99.9	Protein MYSM1; ...	Homo sapiens
XP_513441	99.7	hypothetical pr...	Pan troglodytes
XP_001110190	97.4	similar to myb-...	Macaca mulatta
XP_546688	86.8	similar to CG47...	Canis lupus fam...
XP_001914709	86.3	myb-like, SWIRM...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014778	16	61	PF00249	Myb
	IPR007526	270	359	PF04433	SWIRM
	IPR000555	470	580	PF01398	Mov34/MPN/PAD-1
HMMSmart	IPR001005	15	63	SM00717	SANT
HMMSmart	IPR000555	474	606	SM00232	Mov34/MPN/PAD-1
ProfileScan	IPR001005	11	61	PS50090	SANT
ProfileScan	IPR007526	270	368	PS50934	SWIRM

Primer_f	GGGAATAATAGTTGATGCCAG
Primer_r	TTCCTCATGGCTTTCCTCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-