Gene/Protein Characteristic Table for KIAA0515
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05607
Accession No AB011087
Description proline-rich coiled-coil 2B
Clone name hg00183
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6335 bp)
Predicted protein sequence (670 aa)
Source Human adult brain
Rouge ID mKIAA0515 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6335 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 670 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
NP_037450 1.4e-200 100.0 HLA-B associate...
Homo sapiens
EAW87971 1.4e-200 100.0 hCG30195, isofo...
Homo sapiens
XP_520327 2.4e-200 99.9 hypothetical pr...
Pan troglodytes
EAW87969 5.1e-200 99.9 hCG30195, isofo...
Homo sapiens
EAW87973 1.1e-199 99.9 hCG30195, isofo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB029019 2.3e-07 30.9 KIAA1096
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GTACTGAACCGGAGGGAAAGG
Primer_r ATGGCTAGAGGTGTAATGTGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name GeneBridge 4
Primer_f GTACTGAACCGGAGGGAAAGG
Primer_r ATGGCTAGAGGTGTAATGTGC
PCR product length 133 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp