Order Kazusa clone(s) from : ![]() |
Product ID | ORK01083 |
---|---|
Accession No | AB007859 |
Description | zinc finger, ZZ-type with EF-hand domain 1 |
Clone name | hg00651s2 |
Vector information | |
cDNA sequence | DNA sequence (11394 bp) Predicted protein sequence (2982 aa) |
Flexi ORF Clone |
FXC01083
![]() |
Source | Human adult brain |
Rouge ID |
mKIAA0399
by Kazusa Mouse cDNA Project
|
Note | We replaced hg00651 and hg00651s1, former representative clones for KIAA0399 with hg00651s2. (2002/5/10,2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2444 bp |
---|---|
Genome contig ID | gi51511734r_3754489 |
PolyA signal sequence (AATATA,-31) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 3854489 | 3993002 | 55 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002048 | 136 | 164 | PF00036 | Calcium-binding EF-hand |
IPR004939 | 253 | 418 | PF03256 | Anaphase-promoting complex subunit 10 | |
IPR000433 | 1798 | 1846 | PF00569 | Zinc finger | |
IPR000433 | 1847 | 1891 | PF00569 | Zinc finger | |
HMMSmart | IPR002048 | 136 | 164 | SM00054 | Calcium-binding EF-hand |
IPR000433 | 1798 | 1846 | SM00291 | Zinc finger | |
IPR000433 | 1847 | 1891 | SM00291 | Zinc finger | |
ProfileScan | IPR002048 | 132 | 167 | PS50222 | Calcium-binding EF-hand |
IPR000433 | 1798 | 1848 | PS50135 | Zinc finger | |
IPR000433 | 1847 | 1893 | PS50135 | Zinc finger | |
ScanRegExp | IPR000433 | 1853 | 1879 | PS01357 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 2157 | TLGLLGQLIIRLLPAEVDAAVIK | 2179 | SECONDARY | 23 | 2 | 2262 | NIFTLLVLVGFPQVLCVGTRCVY | 2284 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | GAAAATACGTCACTCCTCTCG |
---|---|
Primer_r | AAGTCCCGCAGAGCAAAGGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GAAAATACGTCACTCCTCTCG |
Primer_r | AAGTCCCGCAGAGCAAAGGTG |
PCR product length | 115 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |