KIAA0517

Product ID	ORK00550
Accession No	AB011089
Description	tripartite motif containing 2, transcript variant 1
Clone name	hg00752
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6740 bp) Predicted protein sequence (792 aa)
HaloTag ORF Clone	FHC00550
Flexi ORF Clone	FXC00550
Source	Human adult brain
Rouge ID	mKIAA0517 by Kazusa Mouse cDNA Project

Length: 6740 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4359 bp
Genome contig ID	gi89161207f_154245068
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AAATCATTATAATAAAGCTTGTTTTCTCCATTTGC
Flanking genome sequence (234858 - 234907)	----+--------+--------+--------+--------+----* AGAGTGAATATTTATTTATTTAATATTTCTCCATTTGCAGAGTGAATATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	4	f	154345068	154479924	12	99.3	Perfect prediction

Length: 792 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX04960	100.0	tripartite moti...	Homo sapiens
EAX04963	99.9	tripartite moti...	Homo sapiens
XP_517485	99.6	tripartite moti...	Pan troglodytes
BAE24679	98.6	unnamed protein...	Mus musculus
EAX04961	99.9	tripartite moti...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029036	6.7e-07	24.0	KIAA1113
AB002296	3.3e-06	19.4	KIAA0298
AB020705	0.00019	23.3	KIAA0898

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	175	192	PR01406	Zinc finger
FPrintScan	IPR000315	193	207	PR01406	Zinc finger
HMMPfam	IPR001841	71	111	PF00097	Zinc finger
	IPR000315	161	202	PF00643	Zinc finger
	IPR001298	373	466	PF00630	Filamin/ABP280 repeat
	IPR001258	534	561	PF01436	NHL repeat
	IPR001258	581	608	PF01436	NHL repeat
	IPR001258	623	650	PF01436	NHL repeat
	IPR001258	670	697	PF01436	NHL repeat
	IPR001258	717	744	PF01436	NHL repeat
	IPR001258	761	788	PF01436	NHL repeat
HMMSmart	IPR001841	71	111	SM00184	Zinc finger
	IPR000315	161	202	SM00336	Zinc finger
	IPR003649	209	335	SM00502	B-box
	IPR001298	372	472	SM00557	Filamin/ABP280 repeat
ProfileScan	IPR001841	71	112	PS50089	Zinc finger
	IPR000315	161	202	PS50119	Zinc finger
	IPR001298	368	469	PS50194	Filamin/ABP280 repeat
	IPR013017	521	564	PS51125	NHL repeat
	IPR013017	568	611	PS51125	NHL repeat
	IPR013017	612	653	PS51125	NHL repeat
	IPR013017	657	700	PS51125	NHL repeat
	IPR013017	704	747	PS51125	NHL repeat
	IPR013017	748	791	PS51125	NHL repeat
ScanRegExp	IPR001841	86	95	PS00518	Zinc finger

Primer_f	TCATTGTAGACTAAAGCATCC
Primer_r	TGCACTCTCTGACATTGATAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCATTGTAGACTAAAGCATCC
Primer_r	TGCACTCTCTGACATTGATAC
PCR product length	166 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles