Gene/Protein Characteristic Table for KIAA0601
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00571
Accession No AB011173
Description lysine (K)-specific demethylase 1A, transcript variant 2
Clone name hg00838a
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (2985 bp)
Predicted protein sequence (886 aa)
Flexi ORF Clone FXC00571
Source Human adult brain
Rouge ID mKIAA0601 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 2985 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 886 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O60341 0 100.0 Lysine-specific...
Homo sapiens
AAH48134 0 99.9 Amine oxidase (...
Homo sapiens
XP_866610 0 99.1 similar to Lysi...
Canis lupus fam...
XP_612243 0 98.7 amine oxidase (...
Bos taurus
Q6ZQ88 0 98.1 Lysine-specific...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007526 208 298 PF04433 SWIRM
IPR002937 322 860 PF01593 Amine oxidase
ProfileScan IPR007526 208 307 PS50934 SWIRM
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GCTTGCCTCCTTTGAATGACC
Primer_r TTGCTTGCCTCAGTCTTTACG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f GCTTGCCTCCTTTGAATGACC
Primer_r TTGCTTGCCTCAGTCTTTACG
PCR product length 88 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp