Gene/Protein Characteristic Table for KIAA0462
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK05603
Accession No AB007931
Description ubiquitin protein ligase E3 component n-recognin 4
Clone name hg00891
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7150 bp)
Predicted protein sequence (2276 aa)
Source Human adult brain
Rouge ID mKIAA0462 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 7150 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 2276 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5T4S7 0 100.0 E3 ubiquitin-pr...
Homo sapiens
EAW94866 0 100.0 zinc finger, UB...
Homo sapiens
XP_513158 0 100.0 retinoblastoma-...
Pan troglodytes
AAL83880 0 100.0 p600 [Homo sapi...
Homo sapiens
XP_001501841 0 98.9 ubiquitin prote...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f CTTTGATGGCTTGGGTTACAG
Primer_r TTTTCTTGGTGTGGCTTGGGG
PCR product length 96 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp