KIAA0330

Product ID	ORK00053
Accession No	AB002328
Description	calcineurin binding protein 1, transcript variant 2
Clone name	hg00894s1
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (7445 bp) Predicted protein sequence (2224 aa)
HaloTag ORF Clone	FHC00053
Flexi ORF Clone	FXC00053
Source	Human adult brain
Note	We replaced hg00894, former representative clones for KIAA0330 with hg00894s1. (2003/4/2)

Length: 7445 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	432 bp
Genome contig ID	gi89161203f_22637903
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTTTTGGTTGCTTTTCTAATAAAGATGGAACAGTT
Flanking genome sequence (266695 - 266744)	----+--------+--------+--------+--------+----* GTCTTTGCCTCTTTGCTCACCTCTAGGGGGCAATCTGGCAGAGTCTCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	22	f	22737903	22904596	37	100.0	Perfect prediction

Length: 2224 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y6J0	100.0	Calcineurin-bin...	Homo sapiens
XP_515030	99.3	calcineurin bin...	Pan troglodytes
XP_543529	90.9	similar to Calc...	Canis lupus fam...
EDL31891	88.7	calcineurin bin...	Mus musculus
O88480	88.0	Calcineurin-bin...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001440	94	127	PF00515	Tetratricopeptide TPR_1
	IPR001440	128	161	PF00515	Tetratricopeptide TPR_1
	IPR001440	1130	1143	PF00515	Tetratricopeptide TPR_1
	IPR015134	2160	2194	PF09047	MEF2 binding
HMMSmart	IPR013026	40	73	SM00028	Tetratricopeptide region
	IPR013026	94	127	SM00028	Tetratricopeptide region
	IPR013026	128	161	SM00028	Tetratricopeptide region
	IPR013026	619	652	SM00028	Tetratricopeptide region
	IPR013026	1059	1092	SM00028	Tetratricopeptide region
ProfileScan	IPR013026	94	127	PS50005	Tetratricopeptide region
	IPR013026	94	161	PS50293	Tetratricopeptide region
	IPR013026	128	161	PS50005	Tetratricopeptide region
	IPR013026	619	652	PS50005	Tetratricopeptide region
	IPR013026	1059	1092	PS50005	Tetratricopeptide region
	IPR013026	1059	1092	PS50293	Tetratricopeptide region
ScanRegExp	IPR001091	1349	1354	PS00093	Site-specific DNA-methyltransferase (cytosine-N4-specific)

Primer_f	AAAAAGGGTGAGGGGTGAGCC
Primer_r	TGTGAAGGTGGATTGGTCGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAAAAGGGTGAGGGGTGAGCC
Primer_r	TGTGAAGGTGGATTGGTCGCC
PCR product length	181 bp
PCR conditions	95 °C15 sec68 °C60 sec30 cycles