Gene/Protein Characteristic Table for KIAA0332
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06982
Accession No AB002330
Description U2 snRNP-associated SURP domain containing
Clone name hg00939
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6823 bp)
Predicted protein sequence (1028 aa)
Source Human adult brain
Rouge ID mKIAA0332 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6823 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1028 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O15042 0 100.0 U2-associated p...
Homo sapiens
XP_534297 0 99.9 similar to U2-a...
Canis lupus fam...
XP_516796 0 99.9 U2-associated S...
Pan troglodytes
EAW78957 0 99.8 hCG27481, isofo...
Homo sapiens
XP_001493107 0 99.7 similar to U2-a...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 275 349 PF00076 RNA recognition motif
IPR000061 430 475 PF01805 SWAP/Surp
HMMSmart IPR000504 274 350 SM00360 RNA recognition motif
IPR000061 427 481 SM00648 SWAP/Surp
IPR006569 536 675 SM00582 Regulation of nuclear pre-mRNA protein
ProfileScan IPR000504 273 354 PS50102 RNA recognition motif
IPR000061 429 472 PS50128 SWAP/Surp
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GTACTGAATAAACACTGAGGC
Primer_r CCAGGGGAAGTGTTGTGATGC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 3
Experimental conditions
Panel name GeneBridge 4
Primer_f GTACTGAATAAACACTGAGGC
Primer_r CCAGGGGAAGTGTTGTGATGC
PCR product length 105 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp