Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK00575 |
---|---|
Accession No | AB014513 |
Description | LIM domain binding 3, transcript variant 1 |
Clone name | hg01088b |
Vector information | |
cDNA sequence | DNA sequence (4223 bp) Predicted protein sequence (734 aa) |
HaloTag ORF Clone |
FHC00575
|
Flexi ORF Clone | FXC00575 |
Source | Human adult brain |
Rouge ID |
mKIAA0613
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001781 | 556 | 610 | PD000094 | Zinc finger |
IPR001781 | 615 | 671 | PD000094 | Zinc finger | |
IPR001781 | 674 | 728 | PD000094 | Zinc finger | |
HMMPfam | IPR001478 | 11 | 88 | PF00595 | PDZ/DHR/GLGF |
IPR001781 | 558 | 614 | PF00412 | Zinc finger | |
IPR001781 | 617 | 673 | PF00412 | Zinc finger | |
IPR001781 | 676 | 733 | PF00412 | Zinc finger | |
HMMSmart | IPR001478 | 18 | 91 | SM00228 | PDZ/DHR/GLGF |
IPR006643 | 196 | 221 | SM00735 | ZASP | |
IPR001781 | 557 | 608 | SM00132 | Zinc finger | |
IPR001781 | 616 | 667 | SM00132 | Zinc finger | |
IPR001781 | 675 | 728 | SM00132 | Zinc finger | |
ProfileScan | IPR001478 | 9 | 91 | PS50106 | PDZ/DHR/GLGF |
IPR001781 | 556 | 614 | PS50023 | Zinc finger | |
IPR001781 | 615 | 674 | PS50023 | Zinc finger | |
IPR001781 | 675 | 734 | PS50023 | Zinc finger | |
ScanRegExp | IPR001781 | 617 | 650 | PS00478 | Zinc finger |
IPR001781 | 676 | 711 | PS00478 | Zinc finger |
RT-PCR |
---|
RT-PCR-ELISA |
Primer_f | TGAATACAAAGCAGCAGGCAG |
---|---|
Primer_r | TGGAGAAAATGACTTAGAGCC |
PCR conditions | 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGAATACAAAGCAGCAGGCAG |
Primer_r | TGGAGAAAATGACTTAGAGCC |
PCR product length | 165 bp |
PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |