KIAA1182

Gene/Protein Characteristic Table for KIAA1182

Order Kazusa clone(s) from :

Product ID	ORK06131
Accession No	AB033008
Description	negative elongation factor complex member B
Clone name	hg01322a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1246 bp) Predicted protein sequence (210 aa)
Source	Human adult brain
Rouge ID	mKIAA1182 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 1246 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	611 bp
Genome contig ID	gi89161216f_139181230
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGATTTTCTCGTATGTAAATAAAAGGCAATTTGGT
Flanking genome sequence (106584 - 106633)	----+--------+--------+--------+--------+----* AAACGTGGAGGCTGAGATGTCTCTGTGCCTGCCCTGAGGTTGGATGTAGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	139281230	139287812	5	99.3	Perfect prediction

Features of the protein sequence

Description

Length: 210 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW88377	3e-82	100.0	cofactor of BRC...	Homo sapiens
EAW88378	3.1e-82	100.0	cofactor of BRC...	Homo sapiens
CAB43381	4e-82	100.0	hypothetical pr...	Homo sapiens
BAB14157	4.6e-82	100.0	unnamed protein...	Homo sapiens
AAH11892	4.6e-82	100.0	COBRA1 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010405	1	210	PF06209	Cofactor of BRCA1

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CCTCTCCTTGTACTTTGGCAG
Primer_r	CACAACCCCAAGGCAGTAAGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 9

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCTCTCCTTGTACTTTGGCAG
Primer_r	CACAACCCCAAGGCAGTAAGC
PCR product length	176 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp