KIAA0408

Product ID	ORK04402
Accession No	AB007868
Description	KIAA0408
Clone name	hg01359
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6581 bp) Predicted protein sequence (662 aa)
Source	Human adult brain

Length: 6581 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3767 bp
Genome contig ID	gi89161210r_127703460
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGTGACAGAGTGAGACTCTGTCTC
Flanking genome sequence (99721 - 99672)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGAACTTATAACTATGACTTGTTCATCTCACCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	r	127803181	127814054	4	99.0	Perfect prediction

Length: 662 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001106088	0	93.4	similar to Temp...	Macaca mulatta
CAB65988	0	100.0	chromosome 6 op...	Homo sapiens
BAE02197	1.1e-192	94.5	unnamed protein...	Macaca fascicularis
XP_001789772	2.6e-134	70.8	hypothetical pr...	Bos taurus
EDL87692	1.5e-93	55.2	rCG42077, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GCGTGGGTGCGGCTGTTAAAC
Primer_r	GGCTTTCTCTTTAGGCTTGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 6

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GCGTGGGTGCGGCTGTTAAAC
Primer_r	GGCTTTCTCTTTAGGCTTGGG
PCR product length	107 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles