Gene/Protein Characteristic Table for KIAA0349
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK07273
Accession No AB002347
Description ubiquitin protein ligase E3 component n-recognin 2
Clone name hg01561
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6158 bp)
Predicted protein sequence (1275 aa)
Source Human adult brain
Rouge ID mKIAA0349 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6158 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1275 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAX04095 0 99.9 ubiquitin prote...
Homo sapiens
CAI95685 0 99.9 ubiquitin prote...
Homo sapiens
Q8IWV8 0 99.9 E3 ubiquitin-pr...
Homo sapiens
BAG64977 0 99.8 unnamed protein...
Homo sapiens
XP_001088394 0 98.0 similar to ubiq...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB095944 3.1e-16 25.2 KIAA2024
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR000408 957 967 PS00626 Regulator of chromosome condensation
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f CCCTGATATGGAAAGCGTATG
Primer_r CTGGTGTTAAGCTAGTTGTCT
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 6
Experimental conditions
Panel name GeneBridge 4
Primer_f CCCTGATATGGAAAGCGTATG
Primer_r CTGGTGTTAAGCTAGTTGTCT
PCR product length 118 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp