KIAA0701

Product ID	ORK05617
Accession No	AB014601
Description	UHRF1 binding protein 1-like
Clone name	hg01611s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4625 bp) Predicted protein sequence (1354 aa)
Source	Human adult brain
Rouge ID	mKIAA0701 by Kazusa Mouse cDNA Project
Note	We replaced hg01611, former representative clones for KIAA0701 with hg01611s1. (2002/5/10)

Length: 4625 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	560 bp
Genome contig ID	gi89161190r_98854985
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- AGCAGATCAATAAACTATATAATTAATGGGTTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATCATCACCCTACTGAACTTACAAAATATCTTGAAAATGTGAAAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	r	98954985	99016452	17	100.0	Terminal No-hit

Length: 1354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001152538	99.4	hypothetical pr...	Pan troglodytes
XP_001152665	99.4	hypothetical pr...	Pan troglodytes
XP_001152470	99.0	hypothetical pr...	Pan troglodytes
XP_001088354	98.5	similar to CG31...	Macaca mulatta
XP_522505	98.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GATGTAGAAGCTGTAACTGGC
Primer_r	TACCACTGGGCTCACACTTTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 12

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GATGTAGAAGCTGTAACTGGC
Primer_r	TACCACTGGGCTCACACTTTC
PCR product length	153 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles