|
Order Kazusa clone(s) from : |
| Product ID | ORK05617 |
|---|---|
| Accession No | AB014601 |
| Description | UHRF1 binding protein 1-like |
| Clone name | hg01611s1 |
| Vector information | |
| cDNA sequence | DNA sequence (4625 bp) Predicted protein sequence (1354 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0701
by Kazusa Mouse cDNA Project
|
| Note | We replaced hg01611, former representative clones for KIAA0701 with hg01611s1. (2002/5/10) |
Length: 4625 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 560 bp |
|---|---|
| Genome contig ID | gi89161190r_98854985 |
| PolyA signal sequence (AATAAA,-27) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 12 | r | 98954985 | 99016452 | 17 | 100.0 | Terminal No-hit |
Length: 1354 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
RT-PCR
|
|---|
Experimental conditions| Primer_f | GATGTAGAAGCTGTAACTGGC |
|---|---|
| Primer_r | TACCACTGGGCTCACACTTTC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 12
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | GATGTAGAAGCTGTAACTGGC |
| Primer_r | TACCACTGGGCTCACACTTTC |
| PCR product length | 153 bp |
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |