KIAA1150

Gene/Protein Characteristic Table for KIAA1150

Order Kazusa clone(s) from :

Product ID	ORK05278
Accession No	AB032976
Description	GATA zinc finger domain containing 2B
Clone name	hg02066
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5051 bp) Predicted protein sequence (499 aa)
Source	Human adult brain
Rouge ID	mKIAA1150 by Kazusa Mouse cDNA Project

Length: 5051 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	3549 bp
Genome contig ID	gi89161185r_151945729
PolyA signal sequence (None)	+--------+--------+----*----+---- TTCTTGATCCATTTAAAAGGAATTGTACATTGTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAAAAAAAAAAAACCTGAAAAAGAGAAAAAAAAGCCCTAGCCATGGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	152045729	152067167	10	99.1	Perfect prediction

Features of the protein sequence

Description

Length: 499 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8WXI9	3.2e-170	100.0	Transcriptional...	Homo sapiens
XP_001144374	4.7e-170	99.8	GATA zinc finge...	Pan troglodytes
BAG52906	1.3e-169	99.6	unnamed protein...	Homo sapiens
XP_001495380	1.5e-169	99.6	GATA zinc finge...	Equus caballus
XP_001929553	1.5e-169	99.6	GATA zinc finge...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000679	326	360	PF00320	Zinc finger
ProfileScan	IPR000679	320	350	PS50114	Zinc finger

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	CAGGGTCAGTTACATAGAAGC
Primer_r	CACTTTACCATGATTAGGGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 1

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CAGGGTCAGTTACATAGAAGC
Primer_r	CACTTTACCATGATTAGGGAG
PCR product length	158 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp