KIAA1185

Product ID	ORK05878
Accession No	AB033011
Description	leucine rich repeat containing 47
Clone name	hg02311a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2080 bp) Predicted protein sequence (403 aa)
Source	Human adult brain
Rouge ID	mKIAA1185 by Kazusa Mouse cDNA Project

Length: 2080 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	868 bp
Genome contig ID	gi89161185r_3586644
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GATGAAAACACATAAATAAAACTACATGCACCATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* GAGGCTTGTGTAAAGACTCTGTGATCACACAGCAGCGGCTAAGCACACGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	3686644	3702360	7	99.5	Perfect prediction

Length: 403 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q8N1G4	4.3e-149	100.0	Leucine-rich re...	Homo sapiens
XP_001915393	1.6e-125	84.7	leucine rich re...	Equus caballus
EDL81252	5.5e-124	83.9	leucine rich re...	Rattus norvegicus
NP_001129138	5.7e-124	83.9	leucine rich re...	Rattus norvegicus
XP_546742	5.7e-124	81.9	similar to Y54E...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	24	37	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	44	57	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	23	44	PF00560	Leucine-rich repeat
HMMPfam	IPR005146	258	325	PF03483	B3/4
HMMSmart	IPR003591	21	44	SM00369	Leucine-rich repeat

Primer_f	AAGTAACAAGTGCCACCAGTC
Primer_r	TTGTGGGATCTGGAAGTTGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGTAACAAGTGCCACCAGTC
Primer_r	TTGTGGGATCTGGAAGTTGTC
PCR product length	162 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles