KIAA1188

Product ID	ORK04583
Accession No	AB033014
Description	calmin (calponin-like, transmembrane)
Clone name	hg02860a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1018 bp) Predicted protein sequence (339 aa)
Source	Human adult brain
Rouge ID	mKIAA1188 by Kazusa Mouse cDNA Project

Length: 1018 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi51511730r_94632710
PolyA signal sequence (AAGAAA,-32)	+--------+--------+----*----+---- TAGAAGAAAATGTAACGAAAGAATCAATCAGTAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAGGAAAAAAGGAAACATGTGGACCACGTAGAAAGTTCACTATT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	94732710	94739870	2	100.0	Perfect prediction

Length: 339 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB14036	2.4e-120	100.0	unnamed protein...	Homo sapiens
AAH32699	2.9e-120	100.0	CLMN protein [H...	Homo sapiens
AAH25251	2.9e-120	100.0	CLMN protein [H...	Homo sapiens
CAB55978	3.5e-120	100.0	hypothetical pr...	Homo sapiens
BAB15087	3.6e-120	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Primer_f	GGGAGACCAAAGAGAATGACC
Primer_r	CGTTACATTTTCTTCTAGGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Chromosome No. 14

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CTGTGATGGCCGATTCCTTCC
Primer_r	GCAAAATCTATTAGGTCGCTG
PCR product length	127 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles