Order Kazusa clone(s) from : ![]() |
Product ID | ORK00837 |
---|---|
Accession No | AB037862 |
Description | zinc finger protein 687, transcript variant 2 |
Clone name | hg02860b |
Vector information | |
cDNA sequence | DNA sequence (5378 bp) Predicted protein sequence (1258 aa) |
Flexi ORF Clone | FXC00837 |
Source | Human adult brain |
Rouge ID |
mKIAA1441
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 694 bp |
---|---|
Genome contig ID | gi89161185f_149421412 |
PolyA signal sequence (ATTAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (109593 - 109642) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 149521412 | 149531003 | 10 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 848 | 870 | PF00096 | Zinc finger |
IPR007087 | 879 | 902 | PF00096 | Zinc finger | |
IPR007087 | 1014 | 1037 | PF00096 | Zinc finger | |
IPR007087 | 1156 | 1179 | PF00096 | Zinc finger | |
IPR007087 | 1221 | 1243 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 554 | 574 | SM00355 | Zinc finger |
IPR015880 | 582 | 606 | SM00355 | Zinc finger | |
IPR015880 | 694 | 714 | SM00355 | Zinc finger | |
IPR015880 | 726 | 748 | SM00355 | Zinc finger | |
IPR015880 | 754 | 778 | SM00355 | Zinc finger | |
IPR015880 | 785 | 808 | SM00355 | Zinc finger | |
IPR015880 | 813 | 836 | SM00355 | Zinc finger | |
IPR015880 | 848 | 870 | SM00355 | Zinc finger | |
IPR015880 | 879 | 902 | SM00355 | Zinc finger | |
IPR015880 | 984 | 1007 | SM00355 | Zinc finger | |
IPR015880 | 1014 | 1037 | SM00355 | Zinc finger | |
IPR015880 | 1044 | 1070 | SM00355 | Zinc finger | |
IPR015880 | 1156 | 1179 | SM00355 | Zinc finger | |
IPR015880 | 1221 | 1243 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 554 | 572 | PS50157 | Zinc finger |
IPR007087 | 726 | 753 | PS50157 | Zinc finger | |
IPR007087 | 785 | 808 | PS50157 | Zinc finger | |
IPR007087 | 848 | 875 | PS50157 | Zinc finger | |
IPR007087 | 879 | 907 | PS50157 | Zinc finger | |
IPR007087 | 1014 | 1042 | PS50157 | Zinc finger | |
IPR007087 | 1156 | 1184 | PS50157 | Zinc finger | |
IPR007087 | 1221 | 1243 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 728 | 748 | PS00028 | Zinc finger |
IPR007087 | 787 | 808 | PS00028 | Zinc finger | |
IPR007087 | 815 | 836 | PS00028 | Zinc finger | |
IPR007087 | 850 | 870 | PS00028 | Zinc finger | |
IPR007087 | 881 | 902 | PS00028 | Zinc finger | |
IPR007087 | 986 | 1007 | PS00028 | Zinc finger | |
IPR007087 | 1016 | 1037 | PS00028 | Zinc finger | |
IPR007087 | 1158 | 1179 | PS00028 | Zinc finger | |
IPR007087 | 1223 | 1243 | PS00028 | Zinc finger |
![]() |
Primer_f | AAGGAGCATGGCAAGTCAGTG |
---|---|
Primer_r | ATGTTTCTCTAGGATCAGGCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |