KIAA1441

Product ID	ORK00837
Accession No	AB037862
Description	zinc finger protein 687, transcript variant 2
Clone name	hg02860b
Vector information	The cDNA fragment was inserted at the NotI site of the The cDNA fragment was inserted at the NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA (NotI site) was ligated with the NotI site of the vector without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector. The cDNA was cloned into the vector in the direction of KpnI site to SacI site of the vector.
cDNA sequence	DNA sequence (5378 bp) Predicted protein sequence (1258 aa)
HaloTag ORF Clone	FHC00837
Flexi ORF Clone	FXC00837
Source	Human adult brain
Rouge ID	mKIAA1441 by Kazusa Mouse cDNA Project

Length: 5378 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	694 bp
Genome contig ID	gi89161185f_149421412
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- AACCAGACCATTAAAACTGTTTGTGGTCGAATCTC
Flanking genome sequence (109593 - 109642)	----+--------+--------+--------+--------+----* CATTCAGGCCTCTCTTTTTCTGTGACTTGGACAATGTGGAGTTGAAGCGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	f	149521412	149531003	10	99.6	Perfect prediction

Length: 1258 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_513792	99.8	zinc finger pro...	Pan troglodytes
Q8N1G0	100.0	Zinc finger pro...	Homo sapiens
XP_001107415	97.7	similar to zinc...	Macaca mulatta
ABY40794	98.0	zinc finger pro...	Papio anubis
ABY82092	95.0	zinc finger pro...	Callithrix jacchus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046849	1.9e-33	36.5	KIAA1629
D86966	6e-10	36.0	KIAA0211

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	848	870	PF00096	Zinc finger
	IPR007087	879	902	PF00096	Zinc finger
	IPR007087	1014	1037	PF00096	Zinc finger
	IPR007087	1156	1179	PF00096	Zinc finger
	IPR007087	1221	1243	PF00096	Zinc finger
HMMSmart	IPR015880	554	574	SM00355	Zinc finger
	IPR015880	582	606	SM00355	Zinc finger
	IPR015880	694	714	SM00355	Zinc finger
	IPR015880	726	748	SM00355	Zinc finger
	IPR015880	754	778	SM00355	Zinc finger
	IPR015880	785	808	SM00355	Zinc finger
	IPR015880	813	836	SM00355	Zinc finger
	IPR015880	848	870	SM00355	Zinc finger
	IPR015880	879	902	SM00355	Zinc finger
	IPR015880	984	1007	SM00355	Zinc finger
	IPR015880	1014	1037	SM00355	Zinc finger
	IPR015880	1044	1070	SM00355	Zinc finger
	IPR015880	1156	1179	SM00355	Zinc finger
	IPR015880	1221	1243	SM00355	Zinc finger
ProfileScan	IPR007087	554	572	PS50157	Zinc finger
	IPR007087	726	753	PS50157	Zinc finger
	IPR007087	785	808	PS50157	Zinc finger
	IPR007087	848	875	PS50157	Zinc finger
	IPR007087	879	907	PS50157	Zinc finger
	IPR007087	1014	1042	PS50157	Zinc finger
	IPR007087	1156	1184	PS50157	Zinc finger
	IPR007087	1221	1243	PS50157	Zinc finger
ScanRegExp	IPR007087	728	748	PS00028	Zinc finger
	IPR007087	787	808	PS00028	Zinc finger
	IPR007087	815	836	PS00028	Zinc finger
	IPR007087	850	870	PS00028	Zinc finger
	IPR007087	881	902	PS00028	Zinc finger
	IPR007087	986	1007	PS00028	Zinc finger
	IPR007087	1016	1037	PS00028	Zinc finger
	IPR007087	1158	1179	PS00028	Zinc finger
	IPR007087	1223	1243	PS00028	Zinc finger

Primer_f	AAGGAGCATGGCAAGTCAGTG
Primer_r	ATGTTTCTCTAGGATCAGGCG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-