KIAA1189

Gene/Protein Characteristic Table for KIAA1189

Order Kazusa clone(s) from :

Product ID	ORK00196
Accession No	AB033015
Description	ermin, ERM-like protein, transcript variant 2
Clone name	hg03032a
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3535 bp) Predicted protein sequence (300 aa)
HaloTag ORF Clone	FHC00196
Flexi ORF Clone	FXC00196
Source	Human adult brain
Rouge ID	mKIAA1189 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 3535 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2632 bp
Genome contig ID	gi89161199r_157783397
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CCACAATTTAAATAAAGAACTGCTGTGTCTGACTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTCAATAAAAGTTTGTGTCTTTATTTCTGGTCTCTAGACTTTATTTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	157883397	157890448	3	100.0	Perfect prediction

Features of the protein sequence

Description

Length: 300 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG59118	3.4e-104	99.7	unnamed protein...	Homo sapiens
XP_515843	2.5e-103	98.6	hypothetical pr...	Pan troglodytes
Q5R6D6	2.4e-97	97.5	Ermin; Juxtanod...	Pongo abelii
XP_001087905	1.2e-92	93.3	hypothetical pr...	Macaca mulatta
XP_849476	1.7e-75	77.5	hypothetical pr...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011259	274	297	PF00769	Ezrin/radixin/moesin

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	GTAGAACTAGAGGTGGGTGAC
Primer_r	GCACAGAGCTAAGAGGACCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 4

Experimental conditions

Panel name	GeneBridge 4
Primer_f	GTAGAACTAGAGGTGGGTGAC
Primer_r	GCACAGAGCTAAGAGGACCAG
PCR product length	102 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp