KIAA0293

Product ID	ORK00499
Accession No	AB006631
Description	cut-like homeobox 2
Clone name	hg03205
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6841 bp) Predicted protein sequence (1505 aa)
HaloTag ORF Clone	FHC00499
Flexi ORF Clone	FXC00499
Source	Human adult brain
Rouge ID	mKIAA0293 by Kazusa Mouse cDNA Project
Note	We replaced ha06241, former representative clones for KIAA0293 with hg03205. (2001/5/29)

Length: 6841 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2227 bp
Genome contig ID	gi89161190f_109856289
PolyA signal sequence (AATACA,-18)	+--------+--------+----*----+---- CTGTAAACGAGTCGCTAAATACAGAATTGTATAAT
Flanking genome sequence (416452 - 416501)	----+--------+--------+--------+--------+----* AATTCTGGGTGTCTTGCTTCTTTGTTCTGGGGCTAGGAGTACAAACTGGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	109956212	110272739	22	99.6	Perfect prediction

Length: 1505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51246	100.0	Cut-like homeob...	Homo sapiens
AAI40441	99.9	Cut-like homeob...	synthetic construct
O14529	100.0	Homeobox protei...	Homo sapiens
AAH65113	83.1	Cut-like homeob...	Mus musculus
P70298	82.9	Homeobox protei...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001356	1188	1245	PD000010	Homeobox
HMMPfam	IPR003350	563	650	PF02376	Homeodomain protein CUT
	IPR003350	906	991	PF02376	Homeodomain protein CUT
	IPR003350	1057	1144	PF02376	Homeodomain protein CUT
	IPR001356	1188	1244	PF00046	Homeobox
HMMSmart	IPR001356	1187	1249	SM00389	Homeobox
ProfileScan	IPR003350	563	650	PS51042	Homeodomain protein CUT
	IPR003350	906	993	PS51042	Homeodomain protein CUT
	IPR003350	1057	1144	PS51042	Homeodomain protein CUT
	IPR001356	1185	1245	PS50071	Homeobox
ScanRegExp	IPR001356	1220	1243	PS00027	Homeobox

Primer_f
Primer_r
PCR conditions	test