KIAA1128

Product ID	ORK05636
Accession No	AB032954
Description	coiled-coil serine-rich protein 2
Clone name	hg03213
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6737 bp) Predicted protein sequence (588 aa)
Source	Human adult brain
Rouge ID	mKIAA1128 by Kazusa Mouse cDNA Project

Length: 6737 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	4970 bp
Genome contig ID	gi89161187f_86021527
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTGGCATAGTAAATAAAAATAAAGTTCATAATTAT
Flanking genome sequence (246724 - 246773)	----+--------+--------+--------+--------+----* AAAAGTTCTCTTGTCTTTCTCAACATTGACTCCCATAGTTTGCTTTTTCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	f	86121527	86268249	10	99.2	Perfect prediction

Length: 588 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001155270	0	99.2	granule cell an...	Pan troglodytes
XP_001085630	0	98.0	similar to gran...	Macaca mulatta
AAG44473	0	100.0	NPD012 [Homo sa...	Homo sapiens
XP_507884	0	99.5	granule cell an...	Pan troglodytes
XP_001927867	5.8e-216	92.5	similar to Prot...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051467	0.00072	25.7	KIAA1680

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	GCCAACATTTTCAGGAGAGAC
Primer_r	AGCTTACCCACTTTCTCCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-