Gene/Protein Characteristic Table for KIAA0622
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04572
Accession No AB014522
Description cytoplasmic linker associated protein 1
Clone name hg04583
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (6951 bp)
Predicted protein sequence (1289 aa)
Source Human adult brain
Rouge ID mKIAA0622 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 6951 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 1289 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q7Z460 0 100.0 CLIP-associatin...
Homo sapiens
EAW95255 0 99.9 cytoplasmic lin...
Homo sapiens
EAW95254 0 99.3 cytoplasmic lin...
Homo sapiens
XP_001504119 0 97.8 cytoplasmic lin...
Equus caballus
Q80TV8 0 97.7 CLIP-associatin...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014527 2.6e-61 67.9 KIAA0627
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 190 226 PF02985 HEAT
IPR000357 1092 1128 PF02985 HEAT
IPR000357 1211 1246 PF02985 HEAT
Expression profile
Description

RT-PCR
RT-PCR-ELISA
Experimental conditions
Primer_f TGCCTTTTCTATGCGCCTCAC
Primer_r TGTTAGCAAAGTCCTGGTGGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 2
Experimental conditions
Panel name GeneBridge 4
Primer_f TGCCTTTTCTATGCGCCTCAC
Primer_r TGTTAGCAAAGTCCTGGTGGG
PCR product length 170 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp