Order Kazusa clone(s) from : ![]() |
Product ID | ORK00516 |
---|---|
Accession No | AB002358 |
Description | spalt-like transcription factor 2, transcript variant 1 |
Clone name | hh00062s1 |
Vector information | |
cDNA sequence | DNA sequence (4910 bp) Predicted protein sequence (1019 aa) |
HaloTag ORF Clone |
FHC00516
![]() |
Flexi ORF Clone | FXC00516 |
Source | Human adult brain |
Rouge ID |
mKIAA0360
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00062, former representative clones for KIAA0360 with hh00062s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 1604 bp |
---|---|
Genome contig ID | gi51511730r_20959074 |
PolyA signal sequence (ATTAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 21059074 | 21075177 | 2 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR007087 | 385 | 407 | PF00096 | Zinc finger |
IPR007087 | 413 | 435 | PF00096 | Zinc finger | |
IPR007087 | 671 | 693 | PF00096 | Zinc finger | |
IPR007087 | 703 | 725 | PF00096 | Zinc finger | |
IPR007087 | 923 | 945 | PF00096 | Zinc finger | |
IPR007087 | 952 | 975 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 385 | 407 | SM00355 | Zinc finger |
IPR015880 | 413 | 435 | SM00355 | Zinc finger | |
IPR015880 | 643 | 665 | SM00355 | Zinc finger | |
IPR015880 | 671 | 693 | SM00355 | Zinc finger | |
IPR015880 | 703 | 725 | SM00355 | Zinc finger | |
IPR015880 | 923 | 945 | SM00355 | Zinc finger | |
IPR015880 | 952 | 975 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 385 | 412 | PS50157 | Zinc finger |
IPR007087 | 413 | 440 | PS50157 | Zinc finger | |
IPR007087 | 643 | 670 | PS50157 | Zinc finger | |
IPR007087 | 671 | 698 | PS50157 | Zinc finger | |
IPR007087 | 703 | 730 | PS50157 | Zinc finger | |
IPR007087 | 923 | 950 | PS50157 | Zinc finger | |
IPR007087 | 952 | 980 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 387 | 407 | PS00028 | Zinc finger |
IPR007087 | 415 | 435 | PS00028 | Zinc finger | |
IPR007087 | 645 | 665 | PS00028 | Zinc finger | |
IPR007087 | 673 | 693 | PS00028 | Zinc finger | |
IPR007087 | 705 | 725 | PS00028 | Zinc finger | |
IPR007087 | 925 | 945 | PS00028 | Zinc finger | |
IPR007087 | 954 | 976 | PS00028 | Zinc finger |
![]() |
---|
Primer_f | GAGAAGCCCATCATAGACAAG |
---|---|
Primer_r | CCTTCCTTCATTTCTCCCTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACTAATATCTCCCGTCTGTTC |
Primer_r | TGCTATTGACTGACTTGAACG |
PCR product length | 97 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |