|
Order Kazusa clone(s) from : |
| Product ID | ORK00516 |
|---|---|
| Accession No | AB002358 |
| Description | spalt-like transcription factor 2, transcript variant 1 |
| Clone name | hh00062s1 |
| Vector information | |
| cDNA sequence | DNA sequence (4910 bp) Predicted protein sequence (1019 aa) |
|
HaloTag ORF Clone |
FHC00516
|
| Flexi ORF Clone | FXC00516 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0360
by Kazusa Mouse cDNA Project
|
| Note | We replaced hh00062, former representative clones for KIAA0360 with hh00062s1. (2002/5/10) |
Length: 4910 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | No warning | Warning |
Integrity of 3' end
| Length of 3'UTR | 1604 bp |
|---|---|
| Genome contig ID | gi51511730r_20959074 |
| PolyA signal sequence (ATTAAA,-18) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 14 | r | 21059074 | 21075177 | 2 | 99.1 | Perfect prediction |
Length: 1019 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR007087 | 385 | 407 | PF00096 | Zinc finger |
| IPR007087 | 413 | 435 | PF00096 | Zinc finger | |
| IPR007087 | 671 | 693 | PF00096 | Zinc finger | |
| IPR007087 | 703 | 725 | PF00096 | Zinc finger | |
| IPR007087 | 923 | 945 | PF00096 | Zinc finger | |
| IPR007087 | 952 | 975 | PF00096 | Zinc finger | |
| HMMSmart | IPR015880 | 385 | 407 | SM00355 | Zinc finger |
| IPR015880 | 413 | 435 | SM00355 | Zinc finger | |
| IPR015880 | 643 | 665 | SM00355 | Zinc finger | |
| IPR015880 | 671 | 693 | SM00355 | Zinc finger | |
| IPR015880 | 703 | 725 | SM00355 | Zinc finger | |
| IPR015880 | 923 | 945 | SM00355 | Zinc finger | |
| IPR015880 | 952 | 975 | SM00355 | Zinc finger | |
| ProfileScan | IPR007087 | 385 | 412 | PS50157 | Zinc finger |
| IPR007087 | 413 | 440 | PS50157 | Zinc finger | |
| IPR007087 | 643 | 670 | PS50157 | Zinc finger | |
| IPR007087 | 671 | 698 | PS50157 | Zinc finger | |
| IPR007087 | 703 | 730 | PS50157 | Zinc finger | |
| IPR007087 | 923 | 950 | PS50157 | Zinc finger | |
| IPR007087 | 952 | 980 | PS50157 | Zinc finger | |
| ScanRegExp | IPR007087 | 387 | 407 | PS00028 | Zinc finger |
| IPR007087 | 415 | 435 | PS00028 | Zinc finger | |
| IPR007087 | 645 | 665 | PS00028 | Zinc finger | |
| IPR007087 | 673 | 693 | PS00028 | Zinc finger | |
| IPR007087 | 705 | 725 | PS00028 | Zinc finger | |
| IPR007087 | 925 | 945 | PS00028 | Zinc finger | |
| IPR007087 | 954 | 976 | PS00028 | Zinc finger |
RT-PCR
|
|---|
Experimental conditions| Primer_f | GAGAAGCCCATCATAGACAAG |
|---|---|
| Primer_r | CCTTCCTTCATTTCTCCCTAC |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 14
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | ACTAATATCTCCCGTCTGTTC |
| Primer_r | TGCTATTGACTGACTTGAACG |
| PCR product length | 97 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |