KIAA0360

Product ID	ORK00516
Accession No	AB002358
Description	spalt-like transcription factor 2, transcript variant 1
Clone name	hh00062s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4910 bp) Predicted protein sequence (1019 aa)
HaloTag ORF Clone	FHC00516
Flexi ORF Clone	FXC00516
Source	Human adult brain
Rouge ID	mKIAA0360 by Kazusa Mouse cDNA Project
Note	We replaced hh00062, former representative clones for KIAA0360 with hh00062s1. (2002/5/10)

Length: 4910 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	Warning

Integrity of 3' end

Length of 3'UTR	1604 bp
Genome contig ID	gi51511730r_20959074
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- GTGTCTTTCCCTCTATCATTAAAGGTGTTTTAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATATTTATGTGTTTCTCCTTATTTCATGATTACATAGCCAGCTGGGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	r	21059074	21075177	2	99.1	Perfect prediction

Length: 1019 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW66378	100.0	sal-like 2 (Dro...	Homo sapiens
NP_005398	99.9	sal-like 2 [Hom...	Homo sapiens
Q9Y467	99.9	Sal-like protei...	Homo sapiens
XP_001154944	99.3	sal-like 2 isof...	Pan troglodytes
EAW66377	98.2	sal-like 2 (Dro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007087	385	407	PF00096	Zinc finger
	IPR007087	413	435	PF00096	Zinc finger
	IPR007087	671	693	PF00096	Zinc finger
	IPR007087	703	725	PF00096	Zinc finger
	IPR007087	923	945	PF00096	Zinc finger
	IPR007087	952	975	PF00096	Zinc finger
HMMSmart	IPR015880	385	407	SM00355	Zinc finger
	IPR015880	413	435	SM00355	Zinc finger
	IPR015880	643	665	SM00355	Zinc finger
	IPR015880	671	693	SM00355	Zinc finger
	IPR015880	703	725	SM00355	Zinc finger
	IPR015880	923	945	SM00355	Zinc finger
	IPR015880	952	975	SM00355	Zinc finger
ProfileScan	IPR007087	385	412	PS50157	Zinc finger
	IPR007087	413	440	PS50157	Zinc finger
	IPR007087	643	670	PS50157	Zinc finger
	IPR007087	671	698	PS50157	Zinc finger
	IPR007087	703	730	PS50157	Zinc finger
	IPR007087	923	950	PS50157	Zinc finger
	IPR007087	952	980	PS50157	Zinc finger
ScanRegExp	IPR007087	387	407	PS00028	Zinc finger
	IPR007087	415	435	PS00028	Zinc finger
	IPR007087	645	665	PS00028	Zinc finger
	IPR007087	673	693	PS00028	Zinc finger
	IPR007087	705	725	PS00028	Zinc finger
	IPR007087	925	945	PS00028	Zinc finger
	IPR007087	954	976	PS00028	Zinc finger

Primer_f	GAGAAGCCCATCATAGACAAG
Primer_r	CCTTCCTTCATTTCTCCCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	ACTAATATCTCCCGTCTGTTC
Primer_r	TGCTATTGACTGACTTGAACG
PCR product length	97 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles