Order Kazusa clone(s) from : ![]() |
Product ID | ORK01074 |
---|---|
Accession No | AB002363 |
Description | SURP and G patch domain containing 2, transcript variant 2 |
Clone name | hh00120s1 |
Vector information | |
cDNA sequence | DNA sequence (5545 bp) Predicted protein sequence (1181 aa) |
HaloTag ORF Clone |
FHC01074
![]() |
Flexi ORF Clone | FXC01074 |
Source | Human adult brain |
Rouge ID |
mKIAA0365
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00120, former representative clones for KIAA0365 with hh00120s1. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1998 bp |
---|---|
Genome contig ID | gi42406306r_18864461 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99715 - 99666) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | r | 18964176 | 19005832 | 10 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000061 | 689 | 732 | PF01805 | SWAP/Surp |
IPR000061 | 887 | 932 | PF01805 | SWAP/Surp | |
IPR000467 | 1110 | 1154 | PF01585 | D111/G-patch | |
HMMSmart | IPR000061 | 686 | 738 | SM00648 | SWAP/Surp |
IPR000061 | 884 | 938 | SM00648 | SWAP/Surp | |
IPR000467 | 1108 | 1154 | SM00443 | D111/G-patch | |
ProfileScan | IPR000061 | 886 | 929 | PS50128 | SWAP/Surp |
IPR000467 | 1110 | 1156 | PS50174 | D111/G-patch |
![]() |
---|
Primer_f | CAAGTGGCATTTCCCGCTCAG |
---|---|
Primer_r | TTCTCCACTCATCCTTCCTTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CAAGTGGCATTTCCCGCTCAG |
Primer_r | TTCTCCACTCATCCTTCCTTG |
PCR product length | 154 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |