KIAA0365

Product ID	ORK01074
Accession No	AB002363
Description	SURP and G patch domain containing 2, transcript variant 2
Clone name	hh00120s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5545 bp) Predicted protein sequence (1181 aa)
HaloTag ORF Clone	FHC01074
Flexi ORF Clone	FXC01074
Source	Human adult brain
Rouge ID	mKIAA0365 by Kazusa Mouse cDNA Project
Note	We replaced hh00120, former representative clones for KIAA0365 with hh00120s1. (2005/08/06)

Length: 5545 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1998 bp
Genome contig ID	gi42406306r_18864461
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCGACAGAGCAAGACTCCATCTCC
Flanking genome sequence (99715 - 99666)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAGGCCGGCACGGTGACTCACGCCTATAATTCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	18964176	19005832	10	99.6	Perfect prediction

Length: 1181 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10324	100.0	splicing factor...	synthetic construct
BAF83964	99.9	unnamed protein...	Homo sapiens
Q8IX01	99.9	Putative splici...	Homo sapiens
XP_001114911	97.3	similar to spli...	Macaca mulatta
EAW84770	99.2	splicing factor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000061	689	732	PF01805	SWAP/Surp
	IPR000061	887	932	PF01805	SWAP/Surp
	IPR000467	1110	1154	PF01585	D111/G-patch
HMMSmart	IPR000061	686	738	SM00648	SWAP/Surp
	IPR000061	884	938	SM00648	SWAP/Surp
	IPR000467	1108	1154	SM00443	D111/G-patch
ProfileScan	IPR000061	886	929	PS50128	SWAP/Surp
ProfileScan	IPR000467	1110	1156	PS50174	D111/G-patch

Primer_f	CAAGTGGCATTTCCCGCTCAG
Primer_r	TTCTCCACTCATCCTTCCTTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAAGTGGCATTTCCCGCTCAG
Primer_r	TTCTCCACTCATCCTTCCTTG
PCR product length	154 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles