Gene/Protein Characteristic Table for KIAA0368
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK04854
Accession No AB002366
Description KIAA0368
Clone name hh00150
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5665 bp)
Predicted protein sequence (1441 aa)
Source Human adult brain
Rouge ID mKIAA0368 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5665 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Features of the protein sequence
Description

Length: 1441 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q5VYK3 0 100.0 Proteasome-asso...
Homo sapiens
EAW59072 0 99.9 hCG28762 [Homo ...
Homo sapiens
CAH90910 0 99.3 hypothetical pr...
Pongo abelii
Q5R6J0 0 99.1 Proteasome-asso...
Pongo abelii
Q6PDI5 0 95.3 Proteasome-asso...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000357 532 569 PF02985 HEAT
IPR000357 753 789 PF02985 HEAT
IPR000357 844 881 PF02985 HEAT
IPR000357 991 1027 PF02985 HEAT
IPR000357 1118 1154 PF02985 HEAT
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GAGATTCCTGGTGTTAACGTC
Primer_r CTGAAAGTGTAGGGTAAGAGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name GeneBridge 4
Primer_f GAGATTCCTGGTGTTAACGTC
Primer_r CTGAAAGTGTAGGGTAAGAGG
PCR product length 145 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp