Order Kazusa clone(s) from : ![]() |
Product ID | ORK01077 |
---|---|
Accession No | AB002369 |
Description | myotubularin related protein 3, transcript variant 3 |
Clone name | hh00252 |
Vector information | |
cDNA sequence | DNA sequence (5886 bp) Predicted protein sequence (1203 aa) |
HaloTag ORF Clone |
FHC01077
![]() |
Flexi ORF Clone | FXC01077 |
Source | Human adult brain |
Rouge ID |
mKIAA0371
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR010569 | 190 | 352 | PF06602 | Myotubularin-related |
IPR000306 | 1119 | 1185 | PF01363 | Zinc finger | |
HMMSmart | IPR003595 | 365 | 514 | SM00404 | Protein-tyrosine phosphatase |
IPR000306 | 1116 | 1185 | SM00064 | Zinc finger | |
ProfileScan | IPR000306 | 1124 | 1184 | PS50178 | Zinc finger |
ScanRegExp | IPR000387 | 416 | 428 | PS00383 | Protein-tyrosine phosphatase |
![]() |
---|
Primer_f | AATATAGGAGCACTGACTGAC |
---|---|
Primer_r | GGTTTCTTGGGTCTGATGTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AATATAGGAGCACTGACTGAC |
Primer_r | GGTTTCTTGGGTCTGATGTAC |
PCR product length | 176 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |