Gene/Protein Characteristic Table for KIAA0371
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK01077
Accession No AB002369
Description myotubularin related protein 3, transcript variant 3
Clone name hh00252
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5886 bp)
Predicted protein sequence (1203 aa)
Flexi ORF Clone FXC01077
Source Human adult brain
Rouge ID mKIAA0371 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5886 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1203 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q13615 0 100.0 Myotubularin-re...
Homo sapiens
BAF82270 0 99.9 unnamed protein...
Homo sapiens
AAI51218 0 99.9 Myotubularin re...
Homo sapiens
XP_001138185 0 99.8 myotubularin-re...
Pan troglodytes
XP_001107561 0 98.1 similar to myot...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB014547 1.5e-161 49.5 KIAA0647
AB028996 6.1e-38 38.3 KIAA1073
AB051469 9.6e-12 34.9 KIAA1682
AB040970 2.9e-07 26.8 KIAA1537
AB046863 3.3e-07 24.9 KIAA1643
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR010569 190 352 PF06602 Myotubularin-related
IPR000306 1119 1185 PF01363 Zinc finger
HMMSmart IPR003595 365 514 SM00404 Protein-tyrosine phosphatase
IPR000306 1116 1185 SM00064 Zinc finger
ProfileScan IPR000306 1124 1184 PS50178 Zinc finger
ScanRegExp IPR000387 416 428 PS00383 Protein-tyrosine phosphatase
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f AATATAGGAGCACTGACTGAC
Primer_r GGTTTCTTGGGTCTGATGTAC
PCR conditions 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name GeneBridge 4
Primer_f AATATAGGAGCACTGACTGAC
Primer_r GGTTTCTTGGGTCTGATGTAC
PCR product length 176 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp