Gene/Protein Characteristic Table for KIAA0376
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06958
Accession No AB002374
Description sperm antigen with calponin homology and coiled-coil domains 1-like
Clone name hh00388
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5515 bp)
Predicted protein sequence (885 aa)
Source Human adult brain
Rouge ID mKIAA0376 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5515 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning Warning
Features of the protein sequence
Description

Length: 885 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_001094607 0 99.9 similar to cyto...
Macaca mulatta
Q2KNA1 0 99.9 Cytospin-A; SPE...
Pan troglodytes
Q69YQ0 0 99.9 Cytospin-A; SPE...
Homo sapiens
Q2KNA0 0 98.5 Cytospin-A; SPE...
Canis lupus fam...
XP_001488757 0 98.4 similar to cyto...
Equus caballus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001715 856 885 PF00307 Calponin-like actin-binding
Expression profile
Description

RT-PCR
Experimental conditions
Primer_f GCCTGGGATCGAGAGAAATAG
Primer_r ACTGTGGGCTTTAGGAATGAC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 22
Experimental conditions
Panel name GeneBridge 4
Primer_f GCCTGGGATCGAGAGAAATAG
Primer_r ACTGTGGGCTTTAGGAATGAC
PCR product length 181 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp