Gene/Protein Characteristic Table for KIAA0477
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06306
Accession No AB007946
Description phosphodiesterase 4D interacting protein
Clone name hh00492
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5676 bp)
Predicted protein sequence (1148 aa)
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 5676 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Features of the protein sequence
Description

Length: 1148 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH78660 0 100.0 Phosphodiestera...
Homo sapiens
AAI32718 0 99.9 Phosphodiestera...
Homo sapiens
CAH72522 0 99.9 phosphodiestera...
Homo sapiens
CAH92060 0 98.0 hypothetical pr...
Pongo abelii
AAI48979 0 90.5 PDE4DIP protein...
Bos taurus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB007923 9.5e-134 97.9 KIAA0454
AB007914 3.5e-05 24.3 KIAA0445
AB028997 4.5e-05 20.5 KIAA1074
AB046853 6.2e-05 21.6 KIAA1633
AB051536 6.3e-05 23.2 KIAA1749
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Experimental conditions
Primer_f
Primer_r
PCR conditions °C sec °C sec cycles

RH mapping information
Description

Chromosome No. 1
Experimental conditions
Panel name GeneBridge 4
Primer_f TTAATTGGTAGCAGGAGAGTC
Primer_r CTTTGGGTAGGAGGAATCTTG
PCR product length 94 bp
PCR conditions 95 °C15 sec62 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp