Order Kazusa clone(s) from :
Japan
||
Other countries |
Product ID | ORK06306 |
---|---|
Accession No | AB007946 |
Description | phosphodiesterase 4D interacting protein |
Clone name | hh00492 |
Vector information | |
cDNA sequence | DNA sequence (5676 bp) Predicted protein sequence (1148 aa) |
Source | Human adult brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.Result of homology search against HUGE database (FASTA output, Multiple alignment)
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C sec °C sec cycles |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTAATTGGTAGCAGGAGAGTC |
Primer_r | CTTTGGGTAGGAGGAATCTTG |
PCR product length | 94 bp |
PCR conditions | 95 °C15 sec62 °C60 sec30 cycles |