Order Kazusa clone(s) from : ![]() |
Product ID | ORK04518 |
---|---|
Accession No | AB046853 |
Description | CDK5 regulatory subunit associated protein 2, transcript variant 2 |
Clone name | fh23696 |
Vector information | |
cDNA sequence | DNA sequence (5966 bp) Predicted protein sequence (1852 aa) |
HaloTag ORF Clone |
FHC04518
![]() |
Flexi ORF Clone | FXC04518 |
Source | Human fetal brain |
Rouge ID |
mKIAA1633
by Kazusa Mouse cDNA Project
|
Note | We replaced fh19672, former representative clones for KIAA1633 with fh23696. (2004/6/03) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 360 bp |
---|---|
Genome contig ID | gi89161216r_122090975 |
PolyA signal sequence (ATTAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 122190975 | 122382238 | 37 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Primer_f | TCTGTGTCATCTCCCGTCAAC |
---|---|
Primer_r | TCCACTCCAACTGATTTTCCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |