Gene/Protein Characteristic Table for KIAA1045
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00721
Accession No AB028968
Description PHD finger protein 24, transcript variant 1
Clone name hh00656
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (5712 bp)
Predicted protein sequence (427 aa)
Flexi ORF Clone FXC00721
Source Human adult brain
Rouge ID mKIAA1045 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 5712 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq Warning No warning
Integrity of 3' end
Length of 3'UTR 4427 bp
Genome contig ID gi89161216f_34848321
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
ACAGTGGAAATCATAATAAAGCGATTGCGATGCTC
Flanking genome sequence
(124222 - 124271)
----+----*----+----*----+----*----+----*----+----*
TGTCGGCTTCCTGTTTCTTGTTGTTTGGGGAACCTGCCATTTCTGTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 9 f 34948321 34972541 8 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 427 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
XP_520427 4.5e-161 99.2 similar to RP11...
Pan troglodytes
CAI29683 1.3e-160 97.3 hypothetical pr...
Pongo abelii
CAH93249 5.4e-159 98.0 hypothetical pr...
Pongo abelii
BAE90573 5.4e-159 97.8 unnamed protein...
Macaca fascicularis
BAE90222 1.1e-150 97.9 unnamed protein...
Macaca fascicularis
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
ScanRegExp IPR001965 160 215 PS01359 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f AGCAGGTGCAGAAGGTGAGTC
Primer_r GCACTACTCTCTTCCTGGACC
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name GeneBridge 4
Primer_f CCTCAAGATTAGCCTCCTGCC
Primer_r GTGTTACTCAAGTGTTCTCAG
PCR product length 99 bp
PCR conditions 95 °C15 sec64 °C60 sec30 cycles
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp