KIAA1045

Gene/Protein Characteristic Table for KIAA1045

Order Kazusa clone(s) from :

Product ID	ORK00721
Accession No	AB028968
Description	PHD finger protein 24, transcript variant 1
Clone name	hh00656
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5712 bp) Predicted protein sequence (427 aa)
HaloTag ORF Clone	FHC00721
Flexi ORF Clone	FXC00721
Source	Human adult brain
Rouge ID	mKIAA1045 by Kazusa Mouse cDNA Project

Features of the cloned cDNA sequence

Description

Length: 5712 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4427 bp
Genome contig ID	gi89161216f_34848321
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ACAGTGGAAATCATAATAAAGCGATTGCGATGCTC
Flanking genome sequence (124222 - 124271)	----+--------+--------+--------+--------+----* TGTCGGCTTCCTGTTTCTTGTTGTTTGGGGAACCTGCCATTTCTGTGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	34948321	34972541	8	99.2	Perfect prediction

Features of the protein sequence

Description

Length: 427 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_520427	4.5e-161	99.2	similar to RP11...	Pan troglodytes
CAI29683	1.3e-160	97.3	hypothetical pr...	Pongo abelii
CAH93249	5.4e-159	98.0	hypothetical pr...	Pongo abelii
BAE90573	5.4e-159	97.8	unnamed protein...	Macaca fascicularis
BAE90222	1.1e-150	97.9	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR001965	160	215	PS01359	Zinc finger

Expression profile

Description

RT-PCR-ELISA

Experimental conditions

Primer_f	AGCAGGTGCAGAAGGTGAGTC
Primer_r	GCACTACTCTCTTCCTGGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information

Description

Chromosome No. 9

Experimental conditions

Panel name	GeneBridge 4
Primer_f	CCTCAAGATTAGCCTCCTGCC
Primer_r	GTGTTACTCAAGTGTTCTCAG
PCR product length	99 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles

Order Kazusa clone(s) from :

Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp