Order Kazusa clone(s) from : ![]() |
Product ID | ORK00579 |
---|---|
Accession No | AB014526 |
Description | microfibrillar-associated protein 3-like, transcript variant 1 |
Clone name | hh00753 |
Vector information | |
cDNA sequence | DNA sequence (6184 bp) Predicted protein sequence (433 aa) |
HaloTag ORF Clone |
FHC00579
![]() |
Flexi ORF Clone | FXC00579 |
Source | Human adult brain |
Rouge ID |
mKIAA0626
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 4776 bp |
---|---|
Genome contig ID | gi89161207r_171044328 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 4 | r | 171144328 | 171184004 | 3 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013098 | 71 | 166 | PF07679 | Immunoglobulin I-set |
HMMSmart | IPR003599 | 77 | 167 | SM00409 | Immunoglobulin subtype |
IPR003598 | 83 | 156 | SM00408 | Immunoglobulin subtype 2 | |
ProfileScan | IPR007110 | 71 | 165 | PS50835 | Immunoglobulin-like |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 29 | KSHLTVCFLPSVPFLILVSTLAT | 51 | PRIMARY | 23 | 2 | 59 | TLNGTNVVLGSVPVIIARTDHII | 81 | SECONDARY | 23 | 3 | 177 | YMVVCLVAFTIVMVLNITRLCMM | 199 | PRIMARY | 23 |
---|
![]() |
---|
![]() |
Primer_f | TAGAAAGGCAAACCAGATACC |
---|---|
Primer_r | ACTCAATGCCAAAAGGGTACG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TAGAAAGGCAAACCAGATACC |
Primer_r | ACTCAATGCCAAAAGGGTACG |
PCR product length | 229 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |